Skip to main content

Table 4 List of primers and their sequences that were used for PCR and genotyping

From: Genetic diversity of Aspergillus flavus and occurrence of aflatoxin contamination in stored maize across three agro-ecological zones in Kenya

Name of marker Group no. Primer sequence (5′–3’) Probe (DYE) Repeat motif and scaffold Expected size range (base pairs)
AF8 1 F: GGCTTGCAAGTCTAATCTGC PET (AAG)16-2911 178
   R: TGTGTCTTTGGGATGTATTTCG    
AF10 1 F: CGTGCCATCGTAGAACTTCC 6-FAM (TAC)10-2504 274
   R: GGGACATTGGTAGTACCTTGG    
AF11 1 F: GACGGCGGTGTACAGTGATAGT NED (AAG)12-2504 142
   R: GCAGTAACGCGATTATGCAAGT    
AF13 1 F: CGTGTTCCAAGTCAAGTCCA VIC (CTT)9-1866 136
   R: TCTCCTTTGCTCCCGTTAGA    
AF16 2 F: AGGTCGTGAAGCCGATACTG 6-FAM (TTG)10-2541 179
   R: CAAAGGCAGATCGAAGGGTA    
AF48 2 F:CCACGTTCCACTGTCTCCTT VIC (AAG)12-2802 352
   R: GCAAGTCCTCCACTGATGGT    
AF54 2 F: GAGAGGTATGCCTTCATGCTTT VIC (ACAT)8-1918 173
   R: AGTGTGTCGACATGGATTGC    
AF53 3 F: TCCTCCAAAGTGACCAAAGC 6-FAM (TCT)8-1918 147
   R: TGCGATTGCTCAGGACATAG    
AF55 3 F: TCATGATCAACCCAGTCCAA PET (GT)10-1739 169
   R: TGGGCAGAATATCCACGTCT    
AF64 3 F: ACTGAGCATTCACCTGCTTG VIC (AC)16-2856 177
   R: ACCTAGCGGGAGGTTCTAGG    
AF18 4 F: CCGCCTCCGAGTGTACTTA NED (TTC)29-1918 198
   R: CAATAAGGATCGCAATCGTACA    
AF25 4 F: GTGAGAGCAATTGGGAAACC VIC (TAC)7 304
     TCC (TAC)-2504  
   R: TGACCAATATGCTGGAGGTG    
AF43 4 F: GTGAGAGCAATTGGGAAACC VIC (GAG)13-2634 392
   R: TGACCAATATGCTGGAGGTG    
\